Receptor 1 hormonu koncentrującego melaninę, nowy cel odpowiedzi autoprzeciwciał w bielactwie ad

Wszystkie surowice trzymano zamrożone w temperaturze około 20 ° C. Badanie to zostało zatwierdzone przez Komisję Etyki w Północnym Szpitalu Ogólnym (Sheffield, Wielka Brytania), a wszyscy badani wyrazili świadomą zgodę. Specyficzne antysurowice. Królicze poliklonalne przeciwciało skierowane przeciw receptorowi receptora melatoniny (anty-MCHR1), MCHR11-S, zakupiono od Alpha Diagnostic International Inc. (San Antonio, Texas, USA). Inne królicze poliklonalne surowice odpornościowe przeciwko białkom specyficznym wobec melanocytu, które stosowano jako kontrole obejmowały antytizytinazę (| PEP7), białko-2 związane z antyjasoninazą (| PEP8) i anty-Pmel17 (AZN-LAM). Budowa biblioteki. Wektor pJuFo (18), podarunek R. Crameri (Szwajcarski Instytut Alergii i Asthmy Research, Davos, Szwajcaria), zmodyfikowano tak, aby umożliwić klonowanie fragmentów DNA z restrykcją SfiI. W skrócie, startery 5. CTAGAGGCCATTA TGGCCTGCAGGATCCGGCCGCCTCGGCCGGTAC3. i 5. CGGCCGAGGCGGCCG GATCCTGCAGGCCATAATGGCCT3. (Life Technologies Ltd., Paisley, Wielka Brytania) traktowano kinazą polinukleotydową T4 (Promega UK Ltd., Southampton, Wielka Brytania), wyżarzano, a następnie ligowano do pJuFo ograniczonego enzymami XbaI (Promega UK Ltd.) i KpnI (Promega). UK Ltd.). Hodowane melanocyty skóry były prezentem od S. MacNeil (Wydział Nauk Klinicznych [North], University of Sheffield, Sheffield, Wielka Brytania). RNA przygotowano z 2 x 106 komórek przy użyciu odczynnika TRIZOL LS (Life Technologies Ltd.), jak opisano w instrukcjach producenta. Całkowity RNA został następnie wykorzystany w zestawie do budowy biblioteki cDNA SMART (CLONTECH Laboratories UK Ltd., Basingstoke, Wielka Brytania), zgodnie z protokołem producenta, w celu przygotowania fragmentów cDNA melanocytów z ograniczeniem SfiI, które następnie zostały zligowane do miejsca SfiI pJuFo. Bibliotekę cDNA melanocytów odzyskano przez elektroporację komórek Escherichia coli XL1-Blue (Stratagene, La Jolla, Kalifornia, USA), jak opisano przez producenta, i wielkość biblioteki oszacowano przez wysianie próbek na agar Luria Bertani (LB) (23). ) zawierającego 50 .g / ml ampicyliny. W celu przygotowania biblioteki fagowej cDNA melanocytów komórki poddane elektroporacji inkubowano przez godzinę w 37 ° C przed superinfekcją za pomocą 1012 jednostek tworzących łysinki pomocniczego faga VCMS13 (Stratagene) w temperaturze pokojowej przez 30 minut. Następnie hodowlę przeniesiono do 100 ml podłoża LB (23) uzupełnionego 50 .g / ml ampicyliny, 10 .g / ml tetracykliny i 10 .g / ml kanamycyny. Po całonocnej inkubacji w 37 ° C, hodowlę odwirowano i fag wytrącono z supernatantu, jak szczegółowo wcześniej opisano (22). Fag ponownie zawieszono w 2. 3 ml PBS i przechowywano w. 20 ° C. Miano faga określano przez infekcję E. coli XL1-Blue w fazie logarytmicznej z porcją biblioteki fagowej, a następnie wysiewanie próbek na agar LB zawierający 50 .g / ml ampicyliny i 10 .g / ml tetracykliny. Izolacja i biotynylacja IgG. IgG wyizolowano z surowicy pacjentów za pomocą chromatografii kolumnowej powinowactwa z białkiem G. Sepharose 4 Fast Flow (Amersham Pharmacia Biotech Europe GmbH, Uppsala, Szwecja). Wyeluowane frakcje IgG zatężono przy użyciu koncentratora Amicon (Amicon Inc., Beverly, Massachusetts, USA). Zatężoną IgG sterylizowano przez filtrację za pomocą jednostki filtracyjnej Millex (Millipore Corp., Bedford, Massachusetts, USA) i końcowe stężenie zmierzono fotometrycznie przy 280 nm. Biotynylowanie IgG przeprowadzono przy użyciu EZ-Link Sulfo-NHS-LC-LC-Biotin (Pierce Chemical Co., Rockford, Illinois, USA), zgodnie z protokołem producenta. Wszystkie próbki IgG przechowywano w temperaturze 4 ° C do momentu, gdy było to wymagane. Biopanning. Próbkę 15 .l biotynylowanej IgG inkubowano z 200 .g streptawidyny Dynabeads M-280 (Dynal Biotech ASA, Oslo, Norwegia), przygotowanej według producenta w 235 .l sterylnej wody i inkubowano w temperaturze 4 ° C. przez 30 minut na obracającej się platformie, aby umożliwić wiązanie Ab-Bead. Próbki Ab użyto w puli od dziesięciu pacjentów z bielactwem z każdym biotynylowanym IgG w stężeniu 2 mg / ml. Aby zablokować niespecyficzne wiązanie faga do kulek później w procedurze, 300 .l 2% wysuszonego mleka w PBS zawierającym 10% glicerolu dodano do zawiesiny perełek IgG i inkubację w 4 ° C kontynuowano przez godzinę. Kompleksy pereł-IgG oddzielono od buforu blokującego stosując Dynal Magnetic Particle Concentrator (Dynal Biotech ASA), przemyto dwukrotnie i ostatecznie ponownie zawieszono w 150 ul PBS / 0,05% Tween 20 przed dodaniem próbki 100 ul. biblioteki fagowej zawierającej 1010 CFU. Zawiesinę następnie inkubowano przez noc w 4 ° C, aby umożliwić oddziaływanie kompleksów kulek Ab z peptydami prezentowanymi na powierzchni cząstek faga.
[patrz też: maciej zagłoba zygler, olejowanie włosów kręconych, gregor laubsch ]
[patrz też: klaudia el dursi, 5lo bydgoszcz, hiperhomocysteinemia ]