Receptor 1 hormonu koncentrującego melaninę, nowy cel odpowiedzi autoprzeciwciał w bielactwie cd

Kompleksy perełek IgG przemyto intensywnie PBS / 0,05% Tween 20 w celu usunięcia niezwiązanego faga. Związany fag wyeluowano z kompleksów perełek IgG z 150 ul 100 mM HCl (doprowadzono do pH 2,2 stałą glicyną) i kulki magnetycznie oddzielono od supernatantu, który zobojętniono 9 | il 2 M Tris-HCl (pH 7,6). Zawiesinę faga stosowano następnie do infekowania 2 ml eksponencjalnie rosnącej E. coli XL1-Blue (Stratagene) przez 15 minut w temperaturze pokojowej. Porcje zakażonych komórek wysiewano następnie na pożywkę selekcyjną, aby umożliwić odzyskanie fagemidu pJuFo. Aby wytworzyć bibliotekę prezentacji fagowej dla kolejnej rundy selekcji, zakażoną hodowlę E. coli XL1-Blue zakażono nadoptymalizowanym fagiem, jak opisano powyżej. Ta pierwsza runda biblioteki wzbogacona w fagi prezentujące peptydy wiążące IgG została użyta w drugiej rundzie selektywnego wzbogacania, jak wyszczególniono powyżej. W sumie podjęto trzy rundy biopanningu. Analiza rekombinowanego fagemidu pJuFo. Poszczególne kolonie, wyizolowane z trzeciej rundy biopanningu przez wysianie bakterii E. coli XL1-Blue zakażonych wyeluowanym fagem, hodowano i fagemid pJuFo wytworzono stosując Wizard Minipreps DNA Purification System (Promega UK Ltd.). Fagemid DNA (50 ng próbek) poddano 36 cyklom amplifikacji PCR w DNA Thermal Cycler (Perkin-Elmer Cetus, Norwalk, Connecticut, USA) ze starterami 1192 5. CCGCTGGATTGTTATTACTCGCTG3. i 1500 5. TGCAAGGCGATT AAGTTGGGTAAC3. (Life Technologies Ltd.), które flankują miejsca klonowania XbaI-KpnI w pJuFo, stosując warunki reakcji opisane wcześniej (24). Produkty amplifikacji PCR analizowano za pomocą elektroforezy w żelu agarozowym (23), aby potwierdzić obecność insertu cDNA i oczyszczono według Wizard Wizard Preps DNA Purification System (Promega UK Ltd.). Sekwencjonowanie produktów PCR przeprowadzono zgodnie z zestawem Sequenase Cycle Sequencing Kit (USB Corp., Cleveland, Ohio, USA) z [. 32P] ATP (ICN Pharmaceuticals Ltd., Basingstoke, Wielka Brytania) i primerem 5. -CCGAAATCGCGAACCTGCTG-3 . (Life Technologies Ltd.), który znajduje się powyżej strony do klonowania XbaI w pJuFo. Zsekwencjonowany DNA poddano elektroforezie w żelach mocznikowych 6% akryloamid / 7 M z tolerowanym glicerolem żelowym buforem (USB Corp.). Sekwencje cDNA porównano z międzynarodowymi bazami danych za pomocą usługi sieci BLAST Narodowego Centrum Informacji Biotechnologicznej (NCBI, Bethesda, Maryland, USA). Klonowanie ludzkiego cDNA MCHR1. Całkowity RNA melanocytów (1 .g) zastosowano do przygotowania cDNA w reakcji 30 .l zawierającej 10 .M DTT, .M dNTP (Promega UK Ltd.), 250 ng losowych starterów (Promega UK Ltd.), 600 U M- MLV RT (Promega UK Ltd.) i bufor 1X M-MLV RT (Promega UK Ltd.). CDNA poddano amplifikacji PCR stosując warunki opisane powyżej dla starterów specyficznych dla MCHR1 5. TTGAATTCGCCGCCATGTTGTGTCCTTCCAAG3. i 5. AATCTAGACGCCTATCAGGTG CCTTTGCTTC3 .. Miejsca restrykcyjne dla EcoRI i XbaI wprowadzono odpowiednio do starterów do przodu i do tyłu, aby umożliwić subklonowanie produktu amplifikacji PCR o długości 1300 pz do pcDNA3 (Invitrogen Ltd., Abingdon, Wielka Brytania), a następnie ekspresję cDNA MCHR1 z promotor T7 w wektorze. Rekombinowany plazmid, pcMCHR1, oczyszczono zestawem QIAGEN Plasmid Maxi (QIAGEN Ltd., Crawley, Zjednoczone Królestwo). Tłumaczenie in vitro. Przeprowadzono translację in vitro pcMCHR1 zgodnie z układem lizatu siatkowego sprzężonego z TnT T7 (Promega UK Ltd.) o stopniu translacji [35S] -metioniny (1000 Ci / mmol, 10 mCi / ml; Amersham Pharmacia Biotech Inc., Little Chalfont , Zjednoczone Królestwo). Glikozylacja MCHR1 została osiągnięta przy użyciu trzustkowych mikrosomalnych membran trzustkowych (Promega UK Ltd.) w warunkach wyszczególnionych przez producenta. SDS-PAGE mRR1 poddanego translacji in vitro p przeprowadzono w 12% żelu poliakryloamidowym, stosując standardowe protokoły (23). Wzmocnione standardy SDS-PAGE (niski zakres) pochodziły z Bio-Rad Laboratories Ltd. (Hemel Hempstead, Zjednoczone Królestwo). Żele były przetwarzane jak wyszczególniono w innym miejscu (9) przed autoradiografią przy. 70 ° C. Testy radiobindingowe. Testy wykonano jak szczegółowo poprzednio (9) z surowicą przy ostatecznym rozcieńczeniu 1:20 i każdą próbką w dwóch powtórzeniach. Specyficzne królicze poliklonalne surowice odpornościowe (MCHR11-S, P PEP7, P PEP8, AZN-LAM) zastosowano w ostatecznym rozcieńczeniu 1: 100. Wskaźnik Ab dla każdej surowicy testowanej w badaniu radiobiałania obliczono następująco: liczba zliczeń na minutę immunoprecypitowana przez badaną surowicę podzielona przez średnią liczbę minut na minutę immunoprecypitowaną przez 28 zdrowych surowic kontrolnych. Każdą surowicę badano w co najmniej dwóch doświadczeniach i obliczano średni indeks Ab
[przypisy: śliwka w czekoladzie kalorie, jacek rybacki, trojanek ]
[więcej w: artur puzio, marcin wójcik żona, warsaw shore odcinek 3 kinomaniak ]