Niedobór czynnika VII ratuje śmiertelność wewnątrzmaciczną u myszy związanych z deficytem inhibitora szlaku tkankowego ad

Analiza fenotypowa potomstwa wynikająca z tej hodowli jest przedmiotem raportu bieżącego. Metody Zwierzęta. Generowanie myszy heterozygotycznych dla fVII (9) i tfpi. (10) opisano geny w mysich podłożach C57B1 / 6 x 129SVJ. Specyficzna konstrukcja delecji FVII polegała na zastąpieniu eksonów 2 do 8 genu fVII (11) genem fosfotransferazy neomycyny (neo), eliminując w ten sposób wszystkie regiony kodujące genu fVII. Modyfikacja genu tfpi polegała na zastąpieniu fragmentów egzonu 4 i intronu D genem fosfotransferazy neomycyny (10). Otrzymane dojrzałe białko jest następnie usuwane z domeny Ku1 TFPI. Myszy podwójnie heterozygotyczne dla fVII i tfpi. (FVII + / A / TFPI + / a) wytworzono przez krzyżowe dopasowanie FVII + / P z TFPI + /. myszy. Analiza genotypowa. Genomowy DNA wyizolowano z końcówek ogonowych lub z części zarodkowych worków żółtkowych, jak opisano wcześniej (12). Do analizy genotypu FVII, fragment DNA o długości 1,2 kb wyizolowany po trawieniu wektora kierującego FVII (pND.FVII) EcoRI i Hindlll został losowo wyznakowany za pomocą. – [32P] dCTP przy użyciu zestawu do znakowania DNA Rediprime (Amersham Life Sciences Inc., Arlington Heights, Illinois, USA). Trawienie genomowego DNA EcoRI, a następnie hybrydyzacja Southern prowadziły do wykrycia pasma 10,5 kb dla allelu fVII typu dzikiego i pasma 6,1 kb dla zrekombinowanego allelu FVII (9). tfpi. genotypy zostały określone przez amplifikację PCR. W tym ostatnim przypadku, trzy startery były jednocześnie stosowane do wykrywania alleli typu dzikiego i zmutowanych alleli tfpi, mianowicie PF z eksonu 4 (GAGCTGGGGTCAATGAAACCGCTGC), PB1 z eksonu 4 (ACACTCTTCCAGGGTATCAAATCGG) i PB2 z genu oporności na neomycynę (ACTTCCTGACTAGGGGAGGAGTAGA). Amplifikacja allelu typu dzikiego powoduje powstanie fragmentu 170-bp, podczas gdy amplifikacja zmutowanego allelu powoduje wykrycie fragmentu 330-bp. Czasowe krycia. Podwójnie heterozygotyczne samice zostały umieszczone późnym popołudniem z nieumiejącymi podwójnie heterozygotycznymi samcami. Rano wykryto wtyczkę pochwy E0.5. Kobiety zostały uśmiercone, a zarodki zebrano we właściwych punktach czasowych. Woreczki żółtkowe z wczesnych stadiów embrionów lub ogonów zarodków późniejszego stadium zostały wyizolowane w celu wyizolowania DNA. Zarodki E9.5 do E14.5 utrwalano przez noc w świeżo przygotowanym 1% roztworze buforowanym fosforanami paraformaldehydu. Zarodki były następnie odwadniane i zatapiane w parafinie. W innym przypadku narządy wycięto i utrwalono w świeżo przygotowanym 1% roztworze buforowanym fosforanami paraformaldehydu. W analizie poporodowej codziennie obserwowano mioty. Kilka miotów uśmiercano zaraz po urodzeniu. Histologia. Osadzone w parafinie narządy podzielono według standardowych protokołów. Skrawki wybarwiono hematoksyliną i eozyną (H & E) (13) lub barwiono immunologicznie w celu wykrycia czynnika von Willebranda (vWF), (3-aktyny i fibryny (ogenu) (14). W przypadku negatywnych kontroli w tych doświadczeniach, barwienie przeprowadzono w nieobecności pierwotnego przeciwciała. Analiza hybrydyzacji Northern mRNA tfpi. Całkowity RNA wyizolowano z zebranych zarodkowych worków żółtka i dorosłych narządów, stosując odczynnik Trizol (Life Technologies Inc., Gaithersburg, Maryland, USA). Próbki homogenizowano najpierw w odczynniku Trizol, a następnie ekstrahowano CHCl3. RNA wytrącono z fazy wodnej izopropanolem. Po odwirowaniu granulowany RNA ponownie zawieszono w H20 bez RNazy i przechowywano w temperaturze <20 ° C. Całkowity RNA poddano elektroforezie na denaturującym żelu agarozowym i przeniesiono na membranę nylonową. CDNA mysiej tfpi i kontrolnej mysiej hprt (transferaza fosforybozylowa hipoksantyny-guanina) cDNA znakowano radioaktywnie a- [32P] dCTP i stosowano jako sondy do hybrydyzacji Northern. Pomiar aktywności FVII. Krew pobierano w cytrynianie z zarodków poprzez bezpośrednie nakłucie serca. Po odwirowaniu przy 3000 rpm przez 10 minut, osocze zebrano i przechowywano w temperaturze ~ 20 ° C do czasu analizy. Aktywność czynnika VII mierzono za pomocą testu Coatest FVII, jak opisano przez producenta (Chromogenix, Bruksela, Belgia). Objętość 50 ul osocza, rozcieńczonego 50 mM Tris-HCl (pH 7,4), 0,2% BSA, wstępnie inkubowano na płytce do mikromiareczkowania w 37 ° C przez 4 min. Próbki inkubowano przez kolejne 7 minut w 37 ° C po dodaniu CaCl2 (6,7 mmol), FX (0,014 U) i rozcieńczonej tromboplastyny. Następnie dodano chromogenny substrat S-2765 (50 | jl 0,94 mM roztworu) i inkubowano w dołkach do próbek w 37 ° C przez dodatkowe 2 min. Szybkość uwalniania P-nitroaniliny zmierzono przy długości fali 405 nm. Pomiar aktywności TFPI. Aktywność TFPI zmierzono w cytrynianowych próbkach osocza za pomocą testu Actichrome TFPI, jak opisano przez producenta (American Diagnostica, Greenwich, Connecticut, USA). [patrz też: empress, przechowywanie kosmetyków, młody jęczmień w proszku ] [więcej w: wypadanie płatka zastawki, duduk, empress ]